Several Acts and Codes of Education During the Victorian Period

Education during the Victorian Period progressed due to several acts and codes over the years. Voluntary schools, which the Church provided, were founded by the Anglican National Society after the grant of 1833 was proposed. The grant went to religious bodies, which were used to build schools. It was the first acceptance by the government to provide the poor with an education. The grant increased to 30,000 pounds in 1839 and then to 100,000 pounds in 1846. These voluntary schools were paid for by private subscription and were spread out over the country. Gladstone†s Bill of 1870 was the work of W.E. Forster, who was an ardent churchman of Quaker origin. The bill doubled the State Grant to church schools and to Roman Catholic schools so they could become a permanent part of the new educational system. There were seven elite boarding schools that were defined as â€Å"Public Schools† in the 1860†³s by the educational Clarendon commission. They were Eton, Harrow, Westminster, Rugby, Winchester, Charterhouse, and Shrewsbury. They were maintained by private funding and received no profits. The Code of 1890 made it possible to maintain evening continuation schools, which we think are night schools. The new schools were known as Board Schools and they were paid for by local rates, or by the local school boards. Church teaching continued in all national schools. Before this, all the churches had to provide the education. The Roman Catholics and the Anglicans wouldn†t let their children go to these schools, though. They felt that these schools did not adequately teach their religious ideas. Board schools were introduced and the Roman Catholics and the Anglicans agreed that these schools satisfied all their educational needs. The acts of 1876 and 1880 made attendance in schools necessary. During the first few years of Queen Victoria†s reign, 30-50% of the children went to school. The most common schools were Sunday schools. They went there if they weren†t working and while there they learned how to â€Å"read† the Bible. Its primary function was to fit people for their place in the social order. From 1870-1890 the average school attendance rose from 1.25 million to 4.5 million and the money spent on each child was doubled. After the New County Council was established, an effective step towards a system of secondary education was taken Only 8% of male children received any secondary education. After the 1870†³s there were a growing number of girls† public schools. They used older children to teach the younger and the education took place in one large room. This made it possible to have fewer teachers and to have lower building costs. With the passage of two acts, you had to go schools until you were 12 years of age and education was provided for the blind and deaf children. It wasn†t until 1899 and the establishment of the National Board of Education that free public education was available to all children in England. The emphasis on modernizing endowments, making scholarships competitive, providing a non-classical course of study as an alternative to the traditional one that emphasized Greek and Latin, establishing house systems, stressing school spirit, emphasizing muscular Christianity and games like football and cricket as means of improving character, became a model for other Victorian public schools. The whole education process was designed to mold students into young Christian gentlemen and ladies. Education During the Victorian Period Education during the Victorian Period progressed due to several acts and codes over the years. Voluntary schools, which the Church provided, were founded by the Anglican National Society after the grant of 1833 was proposed. The grant went to religious bodies, which were used to build schools. It was the first acceptance by the government to provide the poor with an education. The grant increased to 30,000 pounds in 1839 and then to 100,000 pounds in 1846. These voluntary schools were paid for by private subscription and were spread out over the country. Gladstone†s Bill of 1870 was the work of W.E. Forster, who was an ardent churchman of Quaker origin. The bill doubled the State Grant to church schools and to Roman Catholic schools so they could become a permanent part of the new educational system. There were seven elite boarding schools that were defined as â€Å"Public Schools† in the 1860†³s by the educational Clarendon commission. They were Eton, Harrow, Westminster, Rugby, Winchester, Charterhouse, and Shrewsbury. They were maintained by private funding and received no profits. The Code of 1890 made it possible to maintain evening continuation schools, which we think are night schools. The new schools were known as Board Schools and they were paid for by local rates, or by the local school boards. Church teaching continued in all national schools. Before this, all the churches had to provide the education. The Roman Catholics and the Anglicans wouldn†t let their children go to these schools, though. They felt that these schools did not adequately teach their religious ideas. Board schools were introduced and the Roman Catholics and the Anglicans agreed that these schools satisfied all their educational needs. The acts of 1876 and 1880 made attendance in schools necessary. During the first few years of Queen Victoria†s reign, 30-50% of the children went to school. The most common schools were Sunday schools. They went there if they weren†t working and while there they learned how to â€Å"read† the Bible. Its primary function was to fit people for their place in the social order. From 1870-1890 the average school attendance rose from 1.25 million to 4.5 million and the money spent on each child was doubled. After the New County Council was established, an effective step towards a system of secondary education was taken Only 8% of male children received any secondary education. After the 1870†³s there were a growing number of girls† public schools. They used older children to teach the younger and the education took place in one large room. This made it possible to have fewer teachers and to have lower building costs. With the passage of two acts, you had to go schools until you were 12 years of age and education was provided for the blind and deaf children. It wasn†t until 1899 and the establishment of the National Board of Education that free public education was available to all children in England. The emphasis on modernizing endowments, making scholarships competitive, providing a non-classical course of study as an alternative to the traditional one that emphasized Greek and Latin, establishing house systems, stressing school spirit, emphasizing muscular Christianity and games like football and cricket as means of improving character, became a model for other Victorian public schools. The whole education process was designed to mold students into young Christian gentlemen and ladies.

Developmental psychology Essay

Developmental psychology is a field that studies the different stages of development of human psychology. There are many different models of development – theory of cognitive development by Jean Piaget, psychosexual stages of Sigmund Freud, stages of ego development by Jane Loevinger, model of hierarchical complexity by Michael Commons, stages of faith development by James W. Fowler, stages of psychosocial development by Erik Erikson, stages of moral development by Lawrence Kohlberg, hierarchy of needs by Abraham Maslow, etc. Erik Erikson formulated the stages of psychosocial development as an extension of Freud’s stages of psychosexual development. Erikson proposed eight stages of normal human development: Infancy Toddler Pre-school School Adolescence Young adulthood Middle adulthood Late adulthood The primary conflict in infancy or oral sensory age (birth to 12-18 months) is between trust and mistrust. In the toddler or muscular anal age (18 months to 3 years) stage, there is a conflict between autonomy and shame; initiative and guilt in the pre-school or locomotor (3 to 6 years) stage; industry and inferiority in the school latency (6 to 12 years) age; identity and role confusion in the adolescence (12 to 18 years) stage; intimacy and isolation during young adulthood (19 to 40 years); generativity and stagnation in middle adulthood (40 to 65 years); and ego integrity and despair in late adulthood (65 to death). In the first stage a baby is totally dependent on its parents and it is up to the parents to develop a relationship of trust between the child and themselves. Such a child will grow up to be a more secure individual. During the second stage children grain more personal control over their lives such as fetching things for themselves, toilet training and asking for what they want. Play is an important component of the third stage. During the fourth stage children develop sense of accomplishment and pride. In the adolescent stage children are learning to be independent and they attempt to gain a sense of ‘self’. In the sixth and the seventh stages people explore relationships through family, friends and career. The last stage is one retrospection and contemplation. The central element of the psychosocial theory of Erik Erikson is that of ego identity. This identity develops gradually through social interactions. All the conflicts in the different stages of life lead to what is also known as ego quality or ego strength. While Erik Erikson developed the model of Sigmund Frued, Lawrence Kohlberg extended the theory of cognitive development of Jean Piaget. In Kohlberg’s model there are three levels of moral development – pre-conventional, conventional and post-conventional. Obedience, punishment and self-interest are the main preoccupations in the pre-conventional level. The central questions at this level are, â€Å"How to avoid punishment?† and â€Å"What do I get from this?† Social norms and conformation to authority are the main concerns of the conventional stage. At this level people aspire to fulfil social roles. People are driven by approval and/or disapproval of the group that belong to. It becomes important for them to follow rules and conform to dictums and laws. Being accepted by the group is the most important concern during this level. Universal laws and ethics are more important than group-based laws and ethics in the post-conventional stage. This stage is otherwise known as the principled level. At this stage laws are not considered to be rigid or irrevocable. They are thought to be social contracts that entail varied views and opinions. The keywords of Kohlberg’s theory of moral development are – obedience, self-interest, conformity, law and order, human rights and universal human ethics. The mental stages of Kohlberg’s theory of moral development are designed to meet certain criteria: On a qualitative level, they are different ways of thinking. They are structured wholes. The progress of the stages is an invariant sequence. They are hierarchical. They are universal across cultures. Kohlberg uses these stages to explain other cognitive forms, particularly the ability to take roles. In the pre-conventional stage children do not know that there are other viewpoints on every subject. They accept the viewpoint only of the authority figure. They recognize different opinions and viewpoints in the second stage but gravitate towards those views that they themselves hold. People become concerned with the feelings of others during the third and fourth stages.   During the last two stages their worldview expands to include people from other communities and groups. They can identify with the opinions and feelings of ‘other’ people because no law considered absolute and give. Law is a construct and a contract. Kohlberg’s theory has been used in education to help children become active participants in their own moral development. Children are encouraged to discuss and debate moral issues and reach to conclusions on their own. One of the major criticisms of this theory lies with post-conventional stage. Critics have felt that it would be dangerous for people to place their individual values over group values and would be disruptive to communities. Carol Gilligan criticises the theory on the basis that it is totally male oriented and the women have a different path of moral development. Male development emphasizes authority while women emphasize affiliation. Erikson and Kohlberg have both provided important theories that expand on the theories of their predecessors. Erikson’s theory emphasizes social interactions while Kohlberg’s theory emphasises individual ideas and rights. Erikson’s ego identity finds fruition in a life of social interactions while Kohlberg’s ego identity transcends itself and group identities. The latter attributes only normative value to laws and dictums. REFERENCES: Erikson, E.H. (1968). Identity: Youth and Crisis. New York: Norton. Erikson, E.H. (1963). Childhood and Society. (2nd ed.). New York: Norton. Carver, C.S. & Scheir, M.F. (2000). Perspectives on Personality. Needham Heights, MA: Allyn & Bacon. Kohlberg, Lawrence (1981). Essays on Moral Development, Vol. I: The Philosophy of Moral Development. San Francisco, CA: Harper & Row.

Advantages and disadvantages of nationalising mines

Advantages and disadvantages of nationalising mines The Freedom Charter signed and preserved in June 1955 affirmed that the people shall share in the country’s wealth and more significantly ‘the mineral wealth below the soil, the banks, and monopoly industries shall be transferred to the ownership of the people as a whole†. There has been a lot of debate for the nationalisation of South African mines by members of the ANC who deem that it is now the ideal time to cement this item onto the ANC’s agenda for the 2012 Centenary Conference and for this to at last become government policy. According to a variety of reports, it is not the ANC’s national executive committee’s concern and as things stand today it is not government policy. Not everyone is as keen as Julius Malema to have mines nationalised (Mpho, 2011). Foreign investment has already declined due to Malema’s uncertain statements regarding the nationalisation of the South African mines. Advantages of nationalising mines A sector th at is nationalised, allows the government to have direct control over that sector. If the mining sector is nationalised, this would entice the government to sell more minerals within the South African borders rather than export these minerals to foreign countries. If mines were to be nationalised, then the revenue generated would be part of national revenue, and thus would benefit the entire country. Economic development and the total well being of the individual will be improved. South Africa has an unequal distribution of income, this extra revenue will allow government to redistribute income more equally, thus reducing poverty as well as lowering the unemployment rate. There will, however, be a substantial amount of legal and economic costs as well as costs which the government would have to face from the transferring of funds. All of these costs would occur in the short term, increasing government debt. However, in the long run, if the government flourishes, nationailasion of th e mines will benefit the entire nation. Disadvantages of nationailsation Nationalisation would create panic among foreign investors. South Africa has a history of state owned enterprises that haven’t been very successful, this would place more doubt in the mind of the foreign invertor. The mining sector, after nationalisation, could take a very long time to boast a profit. Resources are scarce, therefore during this time, resources may become depleted, resulting in huge losses for the South African economy. There are very large and vast costs that government would have to encounter if the mines of the country are nationalised. Some of these costs include the general operation and running of the mines, possible shutting down of the mines as well as developing the mines. If the government has not shown any signs of profit, these costs will still have to be incurred which could be detrimental to the economy and the well being of the individual South Afrrican. Debt of the governm ent would increase at tremendous rates and this will spill over and result in great fiscal deficits. Clive Coetzee, Kwazulu-Natal Treasury economist stated that the mining industry supports the four macroeconomic goals, economic growth, employment, a low inflation rate and a surplus in the balance of payments. He further states that in 2008 around 500 000 people were employed in the mining sector which contributes to 6, 1% of total non-agricultural formal employment. This is without the indirect effects of mining, if these effects are taken into account another 500 000 jobs are likely to exist. I believe that the private sector already has the necessary capital as well as human resource proficiency to maintain and sustain this sector. Therefore there is no reason to nationalize the mines in South Africa. Nationalisation has been tried in many countries. By looking at countries like Botswana, Zambia and Venezuela, one can clearly see that the nationalisation attempts of these countri es have failed.

Mean Street Movie Review Example | Topics and Well Written Essays - 750 words

Mean Street - Movie Review Example He is also concerned about his dear friend Johnny boy who was played by Robert De Niro. Charlie worked for his uncle and was involved in an affair with Johnny’s cousin played by Amy Robinson who was epileptic in the film. The movie belonged to the genre of westernized gang star films. The characters – The movie showed Johny Boy as a man drowned in the debt of banks who was I love with an epileptic girl Teresa. Charlie was a man who wanted to make it big in the world of gangsters at the same time maintaining his ethics. The character was real going by the mafia world that existed during the 1990s in the streets of Italy. It was appropriate as it portrayed the experiences of people trying to be rich by entering the crime world conflicting with their inner conscience. The film shows how Charlie was unable to free himself from the mafia world. He was compassionate but was not ready to make any commitments of any form either (Mean Streets –Martin Scorsese, 1973). The character of Johnny boy showed the pathetic condition of debt burden. The actors- Robert de Niro and Harvey Keitel are huge talents in themselves. The frustration and despair of a man in debt and the struggle of a man who wanted to earn fame and money by entering the crime world at the same time fighting against his morals were beautifully portrayed by Robert de Niro and Harvey Keitel respectively. The social pangs of epilepsis were played very aesthetically by Amy Robinson (Mean Streets (1973)). The movie theme – The movie was a depiction of the crime, power and self conflicts. It represented the religious conflicts of Charlie and his obsession over guilt. It also featured the aspect of pride and respect seen in such situations where necessasity and moral faiths stand diametrically opposite to each other (Mean Streets –Martin Scorsese). It was made in the genre of the western, war lord,

Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 words

Gene Prediction - Lab Report Example This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039. The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%. Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3 ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA. Fasta formatted sequence was

Thread Rolling Research Paper Example | Topics and Well Written Essays - 500 words

Thread Rolling - Research Paper Example From this paper it is clear that the outcome of transferring the material molecules into thread shape instead of weakening through material removal is the thickening of the molecules at the threads critical parts, mostly in the roots and at the pitch diameter flank. The result of this all is an improvement of the quality of the thread form. Furthermore, the burnishing act that takes place at the steel dies results into a production of a magnificent micro-finish. The internal and external threads assembly is improved by the superior finish. It as well minimizes the wear between mating components thus a life extension results. A smooth finish as well results to an advantage of having rolled threaded components over the threaded components.As the discussion stresses the process involved in the thread rolling is known as the infeed roll threading. The thread types involved are pipe threads/ 600 thread type, machine screw type threads. The forms involved in the process are UNR, UNJ, AND U NC, for classes 1A, 2A, and 3A. The metric forms in the process of roll threading are DIN and ISO. The minimum size for the thread is 2mm, and maximum diameter is 63mm. The pitches in roll threading are fine, coarse and extra fine. The material hardness is cold rolling on depending material size and type. Roll threading results to flight safety threads and left and right hand while the volume that results is 1 to 100,000 pieces.

Strateg.management Essay Example | Topics and Well Written Essays - 1250 words

Strateg.management - Essay Example While in the first two waves, which gave birth to many of the old economy products, the innovation led to tangible goods that could be valued as could the enterprises that produced them. The third wave of IT revolution, however, the product was an intangible commodity - knowledge - that could be shared within and across organizations beyond boundaries. While the potential of the growth of these IT companies was deemed to be enormous, as was evident from the early signals of growth demonstrated by these companies, the stock markets in the USA and Europe reacted far more dramatically between 1990 and 2001. Since most of the owners of the new economy companies were young and first-generation entrepreneurs, there was no way to value the companies on the basis of their net worth. Most of these companies spent enormous amounts of capital, often funded by venture capital, on the hope of much faster growth of future earnings, which were inherently uncertain. As a result, there was a large do se of speculative investments in the stock markets, much of it from the household sector, and the speculative bubble crashed in 2001. In this paper, I will discuss the various aspects in which the valuation of the new economy companies were different from that of the old economy companies by the capital market, demonstrating a dual approach in its valuation process. Intangible inputs and products As Al Gore, Vice President of the United States said at the Microsoft Summit in 1997, "In the Old Economy, the value of a company was mostly in its hard assets - its buildings, machines and physical equipment. In the New Economy, the value of a company derives more from its intangibles - its human capital, intellectual capital, brainpower and heart. In a market economy, it's no surprise that markets themselves have begun to recognize the potent power of intangibles. It's one reason that net asset values of companies are so often well below their market capitalization" (quoted in Bond & Cummins, 2000). The above quote reflects the buoyant mood that policymakers saw the boom in the New Economy in late 1990s. The New Economy was expected to herald in a new growth trajectory on the basis of intangible assets of the company while the product as well was intangible. Hence, the stock markets valued the New Economy in a grossly different manner than it did the Old Economy. While the capital markets valued the Old Economy on the basis of the replacement cost of capital, as was the basis of the Tobin's Q model, the New Economy was valued on the basis of the intangible assets like human and intellectual capital (Bond & Cummins, 2000). Valuation and Replacement cost of capital In theory, the stock market is considered an efficient one when the stock prices reflect the fundamentals of the company accurately. That is, for an efficient stock market, the market value of a company is exactly equal to its fundamental value, defined as the expected present discount value of future payments to the shareholders (Bond & Cummins, 2000). From this, derives the Tobin's Q ratio, that is market valuation to the replacement cost of capital, the latter discounting market power and adjustment costs, which should be 1 for an efficient market. For an

Create a critical review of an article which has made a significant Essay

Create a critical review of an article which has made a significant contribution to the field of business strategy - Essay Example During the contemporary period, it can be seen that organizations operate in a dynamic environment that is characterised by various changes such as the use of digital technology in communication. For instance, Bharadwaj et al (2013), states that â€Å"In a digitally intensive world, firms operate in business ecosystems that are intricately intertwined such that digital business strategy cannot be conceived independently of the business ecosystem, alliances, partnerships, and competitors.† This shows that digital technology has revolutionized the communication landscape and this has a bearing on the operations of any organization. This entails that organizations should also be revolutionary in their strategy formulation in order for them to keep pace with the changes that take place in the environments in which they operate. Since the business environment in which organizations operate is not static, it can be seen that strategy formulation should be an ongoing process. ... Strategy is not all about how it is implemented in business but about how well it is formulated. A poorly formulated strategy is likely to yield poor results as a result of the fact that it may be difficult to implement in the company. When formulating a strategy, different people in the organization should be involved in this process since they can also contribute revolutionary ideas. Strengths of the article The main strength of the article is that it highlights the significant of strategizing the company and it also tries to differentiate it from planning. These two concepts are often confused since they are not synonymous. A company that has strategies in place is in a better position to operate viably since it can revolutionize its operations to meet the changing demands of the environment in which the organizations operate. The other strength of the article is that it clearly states that strategy formulation should not be tied to the aspect of experience since this deprives org anizations the opportunity to revolutionize their operations. The other aspect is that organizations operate in dynamic environments that are constantly changing. This entails that the way we think should not be static as well but it should be revolutionary since it helps the people involved to generate new ideas that can revolutionise the operations of the organization. The other strength of the article is that it highlights the weaknesses that are often encountered in strategy formulation. For instance, the some people think that strategy formulation is a preserve of senior managers in the company alone. However, this misconception often leads to different

The Labor Market Discrimination Essay Example | Topics and Well Written Essays - 1250 words - 2

The Labor Market Discrimination - Essay Example Also, the reduction of the discrimination from the beginning like in schools and the removal of complete disparity at this stage helps in developing more diverse society and a more effective labor market as well. The focus on skills rather than the creed and culture is also a major factor impacting the reduction of the Labor Market Discrimination. Other factors that also impact the Labor Market Discrimination include the opening up of fewer jobs for people and the acceptance of genders, castes and creed helps in improving the condition of the Labor Market Discrimination. The three movies that have been discussed in this class include Freedom Writers, Rossie the Riveter and Crash. The three movies although are of different genres and come from completely different views and insights have the main theme of gender and race discrimination. For instance, the movie Crash is based on a complete racial discrimination where the police officer is against African Americans and hence takes the step of even sexually abusing here in a routine stop. All actions that the police officer takes are based on complete racial discrimination and have a major impact on the story as a whole. In terms of Rossie the Riveter, it is clear that the discrimination is mostly based on the women and how women are treated like they cannot work. In the normal world, there are a number of jobs that are believed to be a ‘man’s job’ and women are considered to be unworthy of doing the job. This story has brought out how women overcome all the conventional beliefs and s how the world that they can work together and can work as well or in fact better than men in a number of occasions as well. Considering the Freedom Writer the story brings out how a culturally mixed class work together and how a woman is able to bring an unruly class to a more organized and well-behaved class.  Ã‚  

Prohibition Era Essay Example for Free

Prohibition Era Essay Prohibition in the United States takes effect on January 17th 1920, this is also known as the 18th amendment. This amendment banned the production, distribution, and sale of alcohol. The majority of the population pushed this law and wanted it to happen, however they did not realize the consequences to come. The prohibition era would be one of the most violent tines in the 20th century. Moonshine is a part of the backwoods culture and prohibition only fuels the fire. With alcohol hard to find moonshiners could charge top dollar for their product. This got more people interested in the production and distribution of illegal liquor because the profit outweighed the risk. The problem with this was rookie moonshiners, because they did not know the safe way, or the safe ingredients to produce moonshine. Also with the increased production brought increased law enforcement. The officers were supposed to destroy any moonshine still they found but were often bribed to look the other way. Another way alcohol was being brought into the U.S. is by boat. Large carrier vessels would stock up in Canada and Jamaica and drop anchor three miles off the coast in international waters, this was called Rum Row. There were over one hundred distribution ships off the coast between Maine and Florida who would sell to any takers. Similar to moonshine the U.S. had to step there game up and beef up the coast guard to catch these rum runners. However the runner’s response to the coast guard was to build bigger and faster boats. Some of these vessels could carry up to two hundred cases of liquor and were equipped with airplane engines. Also some boats could produce a smoke screen and were bullet proof. Then the coast guard did whatever it took to catch the runner’s. They would even open fire on the boat and crew to prevent the shipment from making it to the coast. Most of this illegal alcohol was being sold in private clubs called speakeasies. These clubs had secret rooms and walls to conceal the liquor to fool the police if they were raided. Even with the high risk people were drawn to these clubs because of the thrill of being caught breaking the law. Nevertheless before you could enter into one of these clubs you had to be given the password. But once you were cleared to enter they had all the alcohol you could pay for. Another big player in the Prohibition era was the mobsters. The Bernstein brothers Purple gang and Al Capone’s North Side Gang were the main contenders. They had the public terrorized because they were not afraid to kill anyone, anywhere. The illegal liquor didn’t enter or leave the city without there say so. All of this competition caused a gang war to break out between the Purple gang and the North Side gang. In one massacre the purple gang dressed as police and lined members of the North side gang up against a wall and murdered them. With all of this violence in the U.S. people are fed up with Prohibition law. They realized people are going to drink no matter what the law says. Then to the relief of many Americans on December 5, 1933 President Roosevelt signs the 22nd amendment to revoke prohibition.

Game Mechanics in Racing Game: Research

Game Mechanics in Racing Game: Research Introduction The very first racing game built by KONAMI was Road Fighter (Konami, 1984). The goal of the game was to reach the finish line without running out of fuel. The interesting part was each time the player gets close to finish line without getting crashed; a superman flies by and the player gets extra 1000 points. If you havent noticed before, the superman has K marked on his dress, which probably stands for Konami. But, if you see from a developers point of view, the superman bonus is the result of reward and feedback game mechanics. This point bonus encourages players to play better. It makes the game more interesting and players concentrate more in order to get the bonus Superman points. Game mechanics is a huge subject. It has been used in many fields today, other than video games. Game mechanics have been used for growing the players interest and involvement in gameplay, but as the area of game mechanics became largely successful, it started being used in other fields for other purposes. With the research on game mechanics, I try to study and understand the vast game mechanics subject and its application in various fields. I have also tried to form up a definition and apply it to study gameplay in various games. At last, a thorough study of game mechanics in racing games is attempted, and I introduce a new mechanics for racing games. Research Context The example above explains the game mechanics at quite brief extent. Here, I present some definitions by various researchers as well as own thoughts, experience and some examples. Game Mechanics Definitions Different researchers provide different game mechanics definitions, most likely related to their research. Here are some of the definitions given by some authors. Miguel Sicart defines game mechanics as: Methods invoked by agents for interacting with the game world. (Sicart, 2008) Here, Sicart offered a formal definition for game mechanics as he exercises this definition with a comparative analysis of Shadow of Colossus (Team Ico, 2005), Rez (United Game Artist, 2002) and Every Extend Extra (Q Entertainment, 2006) to research game context and user experience. One of the game mechanics definitions that Sicart has mentioned in his research is by Lundgren and BjÃÆ' ¶rk (2003) as: any part of the rule system of a game that covers one, and only one, possible kind of interaction that takes place during the game, be it general or specific. The definition given by Lundgren and BjÃÆ' ¶rk covers traditional board games and puzzle games, rather than video games. However, they mention that most of the mechanics identified in their research can easily be brewed into video games played on PCs and consoles. It would have been easy to describe these game mechanics without starting from traditional games, but, starting from traditional games also opens up a way that allows easy comparison between computer-based games and non-computerized games. Mike stout (2010) explains how to come up with a better game mechanics when the gameplay is repetitive and boring. Stout describes game mechanics as A major chunk of gameplay. He gives an example of The Legend of Zelda: A Link to the Past (Nintendo, 1991) and the game mechanics used in the game like: sword combat, block pushing, boomerang throwing, swimming, button based puzzles, Hazard-avoidance, etc. (Stout, 2010) Amy Jo Kim explains game mechanics applied in functional softwares and social media as The system and features that makes games fun, compelling and addictive. Kim also explains how game mechanics is brewed into social media like eBay, Facebook, YouTube etc, (Kim, 2009). Game mechanics is a subject that is used in many fields other than video games like, social media, social games and entertainment, consumer products and services etc. Game Mechanics in Social Media Social media sites like facebook.com, eBay.com, youtube.com etc. Implements game mechanics at a very large scale. Amy Jo Kim (2009) explains how collection, points, exchange, feedback and customization mechanics is implemented in social media. For example, ebay.com gives rating and feedback score to the sellers based on the feedback received from customers or buyers. The feedback is accessible through sellers profile page where any user can check the ratings and score. This mechanics improves the seller services. Tesco PLC has implemented point mechanics to attract more customers. The customer gets certain points for purchases made at Tesco shops through Tesco Clubcard. Later, they can redeem points for other offers of items. Tesco makes various offers available through Clubcard points which drive customers to purchase more products. (Tesco, 2010) Jesse Schell (2010) presented multiple examples of game mechanics used in non-game media in his presentation Design outside the Box at DICE Summit 2010. Schell mentions new Ford Fusion hybrid car that comes with an EcoGuide facility, which is basically an implementation of feedback mechanics. Its a virtual plant in techno meter; the plant sprouts more leaves as your miles-per gallon go up, indicating how green your motoring is. (Goodwin, 2009) Here, feedback mechanics is used in such a way that might affect the way people drive their car and possibly encourage them to drive in an eco-friendly way. MouseHunt (HitGrab, 2008) and other facebook games are mainly based on points, feedback, collection, and customization mechanics and MouseHunt can be the best example of it. The player is required to build a mouse trap to catch mice and when a mouse is caught, the player is awarded with points and gold. The game keeps a track of points and gold on leaderboard. The mice caught by the player are added in his collection. Game Mechanics in Mainstream Games Quake (id Software, 1996) popularized rocket jumping mechanics. Rocket jumping is the technique of firing a rocket launcher or similar explosive pointing at the ground or at wall and jumping at the same time. The explosion propels and accelerates the players jump to large distance. Rocket jumping mechanics was introduced in Marathon (Bungie, 1994) and Rise of the Triad (Apogee, 1994), adapted in Team Fortress 2 (Valve, 2007) Unreal Tournament (Epic Games, 1999) and others. (Wikipedia, 2010) Another popular game mechanics is slow motion. The gameplay of Max Payne (Rockstar, 2001) involves bullet time-based action sequences. Bullet time slows the passage of time down to a certain level and enables the player to perform special moves. Time based mechanics is also one of the main features in later versions of Prince of Persia series (Ubisoft, 2003). This mechanics makes the prince able to slow down or rewind the time and perform special combat moves. Portal (Valve, 2007) is a single player Puzzle-Platformer game that consists primarily of a series of puzzles that must be solved by teleporting the players character and simple objects using the portal gun, a unit that can create inter-spatial portal between flat planes. The game received praise for its unique gameplay and darkly humorous story. Portal seems a perfect combination of Challenge and Skills, though its gameplay consist teleportation based puzzles only. The gameplay contains no combat sequence or rocket jumping or slow motion. Kill.switch (Namco, 2003) introduced cover and shoot mechanics which was adapted into Gears of War (Epic Games, 2006). As described by Miguel Sicart (2008) Gears of War introduced an effective combat tactic where the player takes cover behind a block or a pillar and patiently shoots enemies. This third-person combat design also influenced Grand Theft Auto IV (RockStar North, 2008) and became highly popular. But Grand Theft Auto series is more popular for its variety of gameplay which consist of action, adventure, driving, racing, and stealth elements. The GTA series is also a good example of open world type of video game level design concept where a player can roam the virtual world at any point in the game. It also contains sandbox style nonlinear gameplay where the player can complete challenges in any sequence. The Game sold 2.5 million units in the America on the first day. (Mazel, 2008) The roots of open-world game concept go back to space simulator Elite (Acornsoft, 1984). However, we get to see open-world gameplay implementations in Midtown Madness (Microsoft, 1999), Need for Speed Underground 2 (EA Games, 2005) and Burnout Paradise (EA, 2008) as well. Game Mechanics in Racing Games The main gameplay in racing game is driving the car. However, many racing games offer various gameplay that are unique to the game itself. Need for speed: Underground (EA Games, 2003) has a unique win condition. The player has to finish the race at first place only in order to win the race, even if there are more than two players playing. This finish-first only mechanics deliberately increased the challenge level in the game. Underground emphasis heavily on import racing scene and featured vehicles associated with it. Cars can be customized to increase performance and visuals. Underground also featured EA Trax (EA Games) which is a collection of soundtracks. Overall, Need for Speed Underground contains multiple game mechanics that appealed many racing game lovers. According to VGChartz.com, the game sold 6.49 million units of PS2 version of the game till date. (VGChartz, 2010) Trials HD (RedLynx, 2009) is a combination of puzzle and stunt bike driving. It doesnt have any competitive race, as in the player has to get through a number of obstacles with as few crashes as possible. The challenge in the game is to balance and control the speed so that the player can pass through obstacles successfully. The game uses 3D graphics but the player can only more forward and backwards. However, the player can lean front or back to perform special moves or stunts. With such limited movement, the controls are also made simple. Trials HD also has a leaderboard feature, and when connected to Xbox Live, the player can compare his progress with his friends. Split Second (Disney, 2010) introduced destructive environment, which, when triggered by player it creates obstacles for other players. As a player performs stunts like drafting, drifting or precision driving, the powerplay meter builds up which allows the player to trigger special events like creating obstacles, enabling shortcuts or altering the race track entirely. High speed racing, imported cars, customization, stunts, crashes and motion blur can be noted as features of a racing game required to make it best selling. Burnout (Acclaim Entertainment, 2002) is noted as the initial in a series of high-speed racing games which also includes high risk gameplay mechanics. Burnout paradise (EA, 2008), the recent release in burnout series, features an open world environment called Paradise City, with day-night cycle. Game Mechanics include stunts, car crashes, and motorcycles. A very player favourite and famous gameplay is Crash Mode in which players can cause car crashes. However, in burnout paradise, the Crash Mode is called Showtime and records are kept for players biggest crash. The game contains best time for every street in the game which encourages the player to keep on driving to get the best time. Recently released blur (Activision, 2010) incorporates real world cars with arcade style handling and vehicular combat. It introduces a completely new type of gameplay to the current racing genre. However, it is brewed with the power ups mechanics that has been used in many games. It also uses the ranking and perk system. The race starts without a count-down timer which is currently popular; we can see such game mechanics in Split second and need for speed series. Results and Contribution The Definition I would like to give a brief explanation rather than a definition. It is possible that this has been mentioned some or other way in many articles. Game mechanics is a set of rules that builds a specific gameplay which makes the game more challenging, interesting and player-involving. Game mechanics can also introduce new ideas or variety within a game, which ultimately makes a game fun. Game mechanics can be used to build up such a gameplay that motivates or manipulates human behaviour. The definition explained here has been used to study and understand the game mechanics and gameplay in a variety of games mentioned in the research. Game Mechanics In Racing Genre When it comes to racing games, speed is everything. The faster the gameplay is, the more the excitement, interest and challenge will be. In a racing game, the player is not given a high performance car at the beginning of the game, but as he levels up in the game, faster cars or performance upgrades that can boost up the speed are unlocked. This mechanism creates a need of high performance car, and as the player progresses further, the game feels more rewarding. Free roam mode or open world environment plays a crucial part in racing games. Player gets a chance to explore the environment and start the race whenever he wants to, which gives a realistic feeling to the game. Players usually get attracted towards imported cars. Car customization has become an important feature of racing games. Models of original cars are highly praised by players and. They have a tendency to customize their cars and show off as well. Leaderboards allow players to compare their best times, high score and achievements, which also keeps a player engaged in game. Challenge is not the only element a player is looking for in racing games. A number of games provides stunts and car crash based gameplay. Trials HD (RedLynx, 2009) and Burnout series (Criterion Games) are good examples of it. Player can drive through a signboard or perform a stunt in burnout paradise to gain extra boost, where Trials HD is all about passing through obstacles by performing stunt moves. Such game mechanics inserts the element of fun in games. A few arcade style racing games have been avoiding the use of start up countdown. The round starts with ongoing race and the player gains control of the car after a cut scene. This type of mechanics is seen in triple-A titles like Blur and Split second. However, Simulation style racing games, where the realism is more persistent, follows the traditional countdown start-up of a race. Need for speed underground featured finish-first only mechanics. In order to win the round, the player has to finish at first place and first place only. This increases the challenge at a high degree, but it also seemed to be improving the player skills. Other notable game mechanics or gameplay features includes motion blur, car pursuit, allowing player to create tracks etc. Music and soundtracks also play an important part in making the game more interesting. Who wouldnt listen to hip hop or rock music while driving ones favourite car at top speed? It is believed that EA Trax has played an important part in the success of Need for Speed series. Gameplay is designed by brewing multiple game mechanics together. There is no specific recipe to make a best-selling racing game, but a game with various gameplay is more likely get popular. Developing a new Game Mechanic for Racing Games Whether a player is performing stunts, chasing a car, trying to make a huge crash score, or just playing a normal race, the core element is speed. Wouldnt it be great if a car never lose speed unless it is commanded to? Here, I have attempted to come up with such a game mechanic. During a race, if a player hits an obstacle, the car will lose health points but not the speed; the car will continue running throughout the track without losing its speed. However, massive loss in health points will ultimately result the player lose the round. The game presented here demonstrates the game mechanics with some other features as well. The demo consists of a single straight track. Instead of solid obstacles, the player will face white ghosts on track. On colliding with a ghost, the car will go through it but will lose health points. The race does not start with a countdown; instead it begins with the player car running at minimum speed; which increases the challenge from the beginning. On the other hand, if the player runs out of health, or fails to finish the race at first place, he loses the round. But, if the player finishes at first place without losing any health points, he wins a perfect finish. The demo also features some power ups. If the player picks up a health pack, the car health is restored. Slow motion slows down the game, allowing player to easily move through ghosts. Once activated, the game runs in slow motion for 10 seconds. Another power up is a shield which protects player from getting hurt by ghosts or opponent cars. The shield, once activated, stays active for 5 seconds. Shield provides a great advantage. When activated, the car will run 2 points slower than the real speed. Opponents do not collide or influence the players game; however, if collided with opponent cars, the player car will lose health. Evaluation Game Mechanics The following racing mechanics have been implemented into the demo, speed mechanics, power ups, random obstacle mechanics, competition mechanics, countdown less start up and finish first only. The gameplay was changed regularly as the demo was forming up in order to get the optimum effect of the mechanics. Multiple values were changed to improve the difficulty and challenge. However, it was also ensured that the difficulty is not far above the ground. Besides game mechanics, the gameplay can be improved with better feedback, graphical and visual effects, music and sound, more rewards or other bells and whistles. The Gameplay A game demo or a beta version of a game is made for testing purposes. The developers would test the graphics, frame rate or overall performance. Here, the game demo was made for an identical aim. The game demo was given to a group of game enthusiasts. Afterwards the reaction of the players towards the game mechanics was observed. The demo has a look and feel of classic road fighter (Konami, 1984) and the players did miss the superman bonus point. Random obstacles increased the challenge; it made the demo interesting as well. The demo has proved to be an ideal combination of challenge and skill. The players had to concentrate more in order to achieve the perfect finish; several players attempted more tactical approach to win the race. When asked about each feature of the game separately, the replies were encouraging and prove the success of the demo. User Comments Here are some comments given by players who tried the game demo. The game is quiet good; the ghosts were terrible as they ate up all my health in the first round. I rate it 4 out of 5. à ¢Ã¢â€š ¬Ã¢â‚¬Å" Pratik Solanki The concept was different from other games, though the difficulty level was maintained throughout the demo. It seemed easy to win the game, but it was tough to achieve the perfect finish. 3.5 out of 5 à ¢Ã¢â€š ¬Ã¢â‚¬Å" Kushal Joshi The game gets addictive as soon as you start playing   Dirk Fortmeier The Research Game development is not quite possible without understanding game mechanics. Gameplay is an important factor that attracts a player. The research on game mechanics helped to understand why a particular gameplay is more interesting and player involving.

Socialization and Social Stratification Essay -- Sociology

Socialisation is a learning process where people learn and adapt to the appropriate and accepted values, attitudes and behaviours of their society. Nevertheless, separate groups exist within societies for reasons including ethnicity, class and culture and these can bring their own set of ‘norms’. Bond and Bond in Sociology and Social Care (2009 pg28) states â€Å"From the cradle to the grave we are being socialised†. Primary socialisation occurs from infancy to early adulthood. Secondary socialisation follows into the later stages of maturity. Anticipatory socialisation is where we learn to anticipate the actions and activities deemed appropriate by society. Resocialisation occurs when we learn new behaviours in response to new situations and in contrast to behaviours previously learnt and accepted. This can happen when someone receives a prison sentence. They must learn the rules deemed appropriate by those in authority and adapt to shared living and expectations of conduct with other inmates. Throughout the stages of life we learn new skills to deal with different situations. This socialisation process occurs as a result of involvement from agents; ‘situations and people involved in the process of imparting shared social ideas, values and skill’(pg30). Agents include family, peer groups, educational structures and the media. We learn through observation, knowledge and experience. Social Stratification is a hierarchically organised system that classifies people according to power, wealth and status. Sociological perspectives such as functionalism and conflict theory view this practice differently. Functionalism thrives on maintaining structures within society and the people that adhere to the rules of those structures. It views social... ...voice and contributes to the society in which they live. Works Cited Mac Farlane, D. A. (1994). Sociology and Social Care (2009 ed.). Galway: Health Promotion Research Centre, University College Galway, Ireland Kelleher, C., O’Donovan, O., Dineen, B., Becker, G., Gannon, N., O’Kelly, A., et al. (1994). Redefining Health and Wellbeing (2009 ed.). Galway: Centre for Health Promotion Studies, University College Galway, Ireland Partnership, G. C (2011). Galway City Partnerships Strategic Plan 2011 – 2013. Galway: Galway City Partnership. Social Justice – a Scotland where everyone matters; Indicators of Pregress 2003. (n.d). Scottish Government, devolved Government Scotland, devolution, Scottish executive, Scottish Office. Retrieved December 6, 2011, from http://www.scotland.gov.uk/Publications/20

The Trials and Tribulations Faced In One’s Youth :: Personal Narratives Peer Pressure Essays

The Trials and Tribulations Faced In One’s Youth My life has been filled throughout with influences both good and bad. My high school, although plain and simple from the outside, was anything but on the inside. My high school was known for its academic excellence and its more flush attendance area. But, few not and even some who were associated with my school knew of the problem within. A problem that would even be ignored even when it came right to the forefront of the local news. I never knew that drugs could become such a large part of my life, even without doing them. I never expected to ever find myself in trouble in a drug related incident. But, throughout my time in high school I just did what every other person did and ignored it. But I escaped the problem, others weren’t as lucky. My whole life I could not wait to get to high school. I guess it was always conveyed to me to be the best years of my life. So you can imagine how ecstatic I was to finally began attending Sabino High School in Tucson, Arizona. Home to around fifteen hundred or so students. A school set in a nice community, that was always supportive. It always had much parent backing, and the test scores from the school were some of the best in the state, competing with those scores of private schools. There was a problem though, one that would be ignored throughout my class’ tenure there. As a senior I found myself trapped in a school filled with narcotic sales and use. I even found some of my closest friends involved, and none of them were left with a care in the world. My best friend Zane kept his problem from me. It was not until later that he would admit to participating in any sort of drug activity. He would later tell me that throughout our junior year he used cocaine regularly. I knew nothing of this, and as his best friend worried about him when I did find out. I remember being so mad when he told me about his use of cocaine for that year because people would always tell me that they heard that he was doing it, and I always stuck for him and said that it was a lie.

Humor and Healing : The Mind Body Connection :: essays research papers fc

Humor and Healing: The Mind-Body Connection "As it is not proper to cure the eyes without the head, nor the head without the body; so neither is it proper to cure the body without the soul." —Socrates(Cousins, 56) The word, to heal, comes from the root word "haelen" which means to make whole. Bringing together the body, mind and spirit can be healing. The word humor itself is a word of many meanings. The root of the word is "umor" meaning liquid or fluid (Moyers, 221). In the Middle Ages, humor referred to an energy that was thought to relate to a body fluid and an emotional state. This energy was believed to determine health and disposition. In modern dictionaries, humor is defined as "the quality of being laughable or comical" or as "a state of mind, mood, spirit". Humor enhances the creative process and is one of the coping devices used to combat stress and disease. Humor can be used successfully in the classroom, in the workplace, in therapy and counseling, and in medicine to assist in the healing process (Cousins, 78). Laughter improves self-esteem, enhances social interaction, and generally makes life more enjoyable. Laughter can provide a cathartic release, a purifying of emotions and release of emotional tension. Laughter, crying, raging, and trembling are all cathartic activities which can unblock energy flow. Laughter is more than a visual and vocal behavior. It is accompanied by a wide range of physiological changes (Swencionis, 162). During vigorous laughter the body brings in extra oxygen, shudders the internal organs, causes muscles to contract, and activates the hypothalamus, pituitary, and adrenal glands. This results in an increase in the secretion of endorphins (internally produced morphine-like molecules). This â€Å"internal jogging† produces an increase in oxygen absorption, increase in heart rate, relaxation of the muscles, and increases in the number of disease fighting immune cells (Moyers, 230). Humor is a quality of perception that enables people to experience joy even when faced with adversity. â€Å"Stress is an adverse condition during which one may experience tension or fatigue, feel unpleasant emotions, and sometimes develop a sense of hopelessness or futility. Responding to these demands while protecting oneself from the potential harmful impact will help one to remain healthy† (Dreher, 27). Hans Selye, a pioneer researcher in psychosomatic medicine, defines stress as "the rate of wear and tear within the body" as it adapts to change or threat (Dreher, 20).

National Unity

CPPS Policy Factsheet: National Unity CPPS is pleased to bring to you its â€Å"CPPS Policy Fact Sheet† on national unity. In this factsheet, we will look at government policies which affect national unity and explore their effects on social cohesion and integrity in Malaysia. BACKGROUND Malaysia is one of the most plural and heterogeneous countries in the world, with three major ethnic groups — Malay, Chinese, and Indian — plus several other indigenous tribes. It has a checkered history, having been under four different colonial powers at one time or another since the 16th century. This ethnic and cultural diversity is reflected in the wide variety of languages spoken and religions practiced in Malaysia; even within the same ethnic group, various traditions prevail. Modern Malaysia is increasingly forced to confront the tensions arising from this fount of diversity, and the politics of race and religion. Malaysia has been free of ethnic bloodshed, but there remains much room for Malaysians to understand one another and to see each other as equal parts of an indivisible nation. National unity is a key target of government policy; the Department of National Unity is tasked with promoting greater integration amongst the country’s various communities. However, numerous government policies and laws differentiate between Malaysians on the basis of ethnic background, to the point that many feel they have been the target of discrimination. Overall Malaysians are pleased with the progress the country has made in coming to terms with its plural and diverse nature. Yet, there is still significant room for improvement and ensuring that every Malaysian believes there is a place for them under the Malaysian sun. FLASH POINTS The Department of National Unity defines national unity as â€Å"a situation in which all citizens from the various ethnic groups, religions, and states live in peace as one united nationality, giving full commitment to national identity based upon the Federal Constitution and the Rukunegara. † Wawasan 2020 (Vision 2020), a government policy targeting developed status for Malaysia by the year 2020, names national unity as a key component of a developed country. The â€Å"Bangsa Malaysia† (Malaysian Nation) policy mphasises â€Å"people being able to identify themselves with the country, speak Bahasa Malaysia (the Malay language) and accept the Constitution. † Prior to Bangsa Malaysia, the government’s main thrust towards national unity was the National Culture Policy implemented in 1971, which defined the â€Å"indigenous culture† and Islam as two important bases for the national culture. The 2006 National Education Blueprint targets ra cial polarisation in the school system, aiming to use classes on the Constitution and other such activities to bring students together, while promoting Mandarin and Tamil classes in national schools. In 2008, the government announced new quotas for government scholarships, with 55% allocated to the bumiputra and 45% for non-bumiputra; previously the quota stood at 90% to 10%. The old ethnic quota system in university admissions was abolished in 2004. The National Service programme which commenced in 2003 is meant to address racial polarisation and encourage national unity by bringing youths from a variety of backgrounds together in one setting. The New Economic Policy and other associated affirmative action programmes have helped dampen Malay fears of falling behind the rest of the nation socioeconomically, but also led to concerns of government-backed discrimination amongst the non -Malay communities. BASIC STATISTICS and FACTS Malays and other bumiputra comprise 65% of the population; Chinese make up 26%, and the Indians 8%. (2000 census) 60. 4% of Malaysians are Muslim, 19. 2% are Buddhist, 9. 1% are Christian, 6. 3% are Hindu, 2. % follow Confucianism/Taoism/ another traditional Chinese faith, and 2. 4% practice other faiths. (2000 census) 93% of Malays attend national schools, 90% of Chinese attend Chinese vernacular schools, and 70% of Indians attend Tamil vernacular schools. (Prime Minister’s address to the 2004 Malaysian Education Summit) Bumiputra corporate equity stands at 19. 4%. (Mid-Term Review of the 9th Malaysia Plan) 41% of Malaysians either describe national unity as â€Å"superficial† or â₠¬Å"imposed†, or believe there is no national unity at all in Malaysia. Merdeka Centre Ethnic Relations Perceptions Poll) 25% believe that Malaysians from different ethnic groups are drifting apart rather than becoming more united, and 15% believe that the situation will only worsen over the next decade. (Merdeka Centre Ethnic Relations Perceptions Poll) There is a clear correlation between age and mixing outside one’s own ethnic group; younger Malaysians are likelier to say they find it difficult to relate with those not from their own racial background, and less likely to say they like mixing with people of a different race. CPPS Minda Muda study) 22% do not have any friends from ethnic groups other than their own. Of those who do, 60% rarely or never take meals with their friends from other ethnic backgrounds. (Merdeka Centre Ethnic Relations Perceptions Poll) Roughly 2/3rds of young Malaysians’ close friends are primarily from the same ethnic group or religion as them. (CPPS Minda Muda study) Only 57% of Malaysians believe that government policies should focus on promoting interests common to all Malaysians, with 25% believing that government policies should focus on the interests of specific ethnic groups. Merdeka Centre Ethnic Relations Perceptions Poll) 75% of young Malays can say they have never been treated unfairly on account of their race; however, only 45% of their Chinese peers and 49% of the Indians say the same. For religious discrimination, the same figures stand at 82% for the Malays and 53% for others. (CPPS Minda Muda study) Recent polls suggest that ethnic inequality is the 2nd-most pressing issues faced by Malaysians, at 17%, with only price hikes and inflation considered more pressing, coming in at 20%. 3% are somewhat or very dissatisfied with government efforts to address ethnic inequality. (Merdeka Centre Voter Opinion Poll 4 th Quarter 2007) Article 153 of the Federal Constitution states: â€Å"It shall be the resp onsibility of the Yang di-Pertuan Agong to safeguard the special position of the Malays and natives of any of the States of Sabah and Sarawak and the legitimate interests of other communities in accordance with the provisions of this Article. † Article 153 has been used to permit quotas in the provision of public scholarships, civil service positions, and business licences. EDUCATION POLICIES Young Chinese Malaysians are considerably dissatisfied with the state of the education system when it comes to promoting national unity. (CPPS Minda Muda study) 64% of Chinese parents feel the education system is preparing students to be tolerant towards those of other races and religions, as opposed to 78% of Malay parents and 83% of Indian parents. (Merdeka Research Centre Education System Perceptions Survey) 86% of Malaysians believe that the time has come for a national education convention involving all races to review various aspects of our education policies. Merdeka Centre Education System Perceptions Survey) 42% of Malaysian youth reject a quota system for admissions to public universities. (Merdeka Centre Youth Expectations Survey) 37% of Malaysians believe that the streaming of primary education based on mother tongue will negatively affect ethnic relations in the long run. (Merdeka Centre Ethnic Relations Perceptions Poll) 12% believe that the best way to improve ethnic relations in the country is to standardise on one education system. Merdeka Centre Ethnic Relations Perceptions Poll) Incidents of intolerance in the school system are often publicised in the media. Recently, a teacher told her students Indians were monkeys and children of prostitutes. The government’s response in such cases has been unsatisfactory; in here, the teacher was only transferred, with no further apparent penalty. Students often attend different primary school systems according to their mother tongue, curbing opportunities for interaction between young of different ethnic backgrounds. At the secondary level, many bumiputra students opt for one of the MARA junior science colleges or other bumiputra-dominated boarding schools, further reducing young Malaysians’ exposure to peers from different backgrounds. Universiti Teknologi Mara (UiTM) is exclusively attended by bumiputra students; suggestions by Selangor Chief Minister Tan Sri Khalid Ibrahim that it take in 10% of non-bumiputra was protested violently by students. A former Minister of Higher Education publicly declared that he would never see non-bumiputra students set foot on the campus. Although the quota system for university admissions has been abolished, there are regular calls from within the ruling party (Umno) for its restoration. Suspicions remain that the quota system is still in place by de facto, as the proportion of admitted bumiputra continues to hover between 50% and 60%. The quota system for government scholarships remains, and moves to increase the non-bumiputra quota or abolish the quotas entirely have come under fire. National Service is a popular remedial programme for racial integration; 73% of youth believe it has a positive effect on national unity, and 87% say it ought to be retained. Merdeka Centre Youth Expectations Survey) ECONOMIC POLICIES The NEP has ended but broadly refers to affirmative action for the Bumiputera in social, economic, corporate, distributive trade, and educational aspects. Its relevance has been debated recently, with some groups calling to replace this with a non-racebased affirmative action policy, focusing instead on n eed and meritocracy. A key target of the NEP was to have the bumiputra control 30% of corporate equity by 1990; when this target was not met, successor policies continued with a variety of bumiputra preferences. The 30% goal remains a key target in economic policy, and claims that it has already been attained have met with withering criticism Under the Industrial Coordination Act, the state has wide-reaching powers to achieve the 30% target. This power was most frequently used in the 1970s, when vast restructuring of numerous private enterprises took place. Public corporations must have a bumiputra equity stake of at least 30%, although there are exceptions granted. Tax breaks for companies with 30% or more bumiputra ownership are common. The state has taken over several foreign enterprises and established numerous government-linked corporations (GLCs) with the explicit purpose of increasing the bumiputra equity share. Loose employment quotas apply to large establishments, which must employ staff in the same proportions as the overall ethnic composition of the country. Similar quotas also apply to the boards of directors for a number of firms. Civil service positions are subject to even more stringent quotas; a common and targeted ratio is 4 bumiputra to 1 non-bumiputra. There are overt bumiputra preferences in public procurement, where construction contracts, etc. re frequently given to bumiputra-controlled firms without an open tendering process. Government policy is to encourage GLCs to follow government procurement procedures, extending the preferences to the commercial sector. In a controversial move, Maybank in 2007 announced it would only utilise law firms with a bumiputra ownership stake of 51% or more; after public outcry, the policy was rolled back. Price discrimination, whereby the government subsidises bumiputra contractors’ bids, is also a frequent practice. All new real estate developments are required to provide a certain discount for bumiputra buyers. Shares in initial public offerings (IPOs) meant for bumiputra ownership are also frequently sold at a discount. No government policy has ever set explicit targets for inter- or intra-ethnic income inequality. The government monitors the incomes of various ethnic groups, but reducing income disparities or uplifting the poor in general is not a major priority. Studies indicate significant dissatisfaction amongst the Chinese population with the government’s economic policies, which a substantial number perceive as detrimental to national unity. CPPS Minda Muda study) 39% of Malaysian youth believe that Malay preferences in government assistance ought to be abolished. (Merdeka Centre Youth Expectations Survey) Source: CPPS Minda Muda study Policies for a Particular Group Only Sta teme nts on Econ Policies good for Economic unity Policie s 1. 17 1. 04 1. 96 0 1 2 3 4 5 2. 17 1. 93 2. 48 4. 01 3. 4 4. 2 Indian/Others Chinese Malay NEP good for unity RELIGION and the LAW Amongst non- Muslims, concern is growing that Islamic law as practiced in Malaysia impinges on some of their rights. The Lina Joy case in 2007 ended with the apex Federal Court ruling 2-1 that Malaysians legally defined as Muslims cannot convert out of Islam without going through the Muslim Syariah court system. In 2005 Maniam Moorthy (also known as Mohammad Abdullah) was buried as a Muslim because official records indicated he had converted from Hinduism to Islam; his family protested as he had never given them any indication of conversion, and continued to practice the Hindu faith. The civil courts refused to hear the matter, and referred the Hindu family to the Muslim Syariah courts. In 2005, T. Saravanan converted from Hinduism to Islam, and filed an application in the Syariah Courts to dissolve his civil marriage and gain custody of his children. His wife, R. Subashini, insisted that only the civil courts could dissolve a civil marriage, but the civil courts held that they had no jurisdiction over the matter because as a Muslim Saravanan was now subject to Islamic family law. 2007 saw the case of Revathi Massosai, whose parents had registered her as a Muslim at birth, but had been raised as a practicing Hindu by her grandmother. When she filed an application to change her legal status from Muslim to Hindu, she was detained by Muslim religious authorities and sent for rehabilitation, where she claimed she was forced to consume beef and follow Muslim religious traditions. Numerous non-Muslim places of worship, primarily Hindu temples, have been demolished in recent years as illegal structures on public land. Non-Muslim activists claim that as historical landmarks, many of these buildings should have remained standing, and allege government discrimination in targeting non-Muslim places of worship. Interfaith dialogue has often been attacked as a challenge to the position of Islam, which is the official religion of Malaysia. Attempts to set up an Interfaith Commission have been rebuffed as a non-Muslim attempt to regulate Islamic beliefs, and civil society-organised forums on Muslim religious issues such as conversions have been forced to a premature close by vocal protests. Top government officials, including the present Prime Minister and his predecessor, have declared Malaysia an Islamic state although no related amendments to the law have been made. It is not clear what ramifications this has in store for the nonMuslim communities, but some fear this is an implicit justification for perceived injustices like the aforementioned cases. Mean Ranks Respondents were asked to rank on a 5-point scale the following statements, with â€Å"1† as â€Å"Fully Disagree† and â€Å"5† as â€Å"Fully Agree. The statements here read: â€Å"Government policies to help the poor should be for a particular group of Malaysians only. † â€Å"Government economic policies are good for national unity. â€Å"I think the NEP has been good to unite the country together. † IDENTITY and POLITICS 45% of Malaysians see themselves as Malaysian first, with 42% (including over half the Malays) identifying primarily as members of their respective ethnic groups. 12% believe they are equally Malaysians and equally members of their own ethnic communities. (Merdeka Centre Ethnic Relations Perceptions Poll) Young Malaysians have diff erent orientations; 40% say they see themselves as Malaysian first, but 39% — mostly Malay — identify primarily as the member of a religious group. 0% of Chinese Malaysian youths see themselves as a member of their own ethnic group first, as opposed to 7% each for the Malays, Indians and non-Muslim bumiputra. (DiGi Snapshot: MERDEKA Youth in Focus) Ethnic stereotyping is prevalent, with 58% of Malaysians saying Malays are lazy, 65% saying Chinese are greedy, and 58% saying Indians cannot be trusted. (Merdeka Centre Ethnic Relations Perceptions Poll) 70% of Malaysians believe they should help those from their own ethnic group first before helping others. Only 56% are more concerned about other Malaysians than their Muslim, Chinese or Indian counterparts overseas. (Merdeka Centre Ethnic Relations Perceptions Poll) 75% view their own culture as superior to other Malaysian cultures. However, 92% say they are happy to live in Malaysia because they get to enjoy different cultures. (Merdeka Centre Ethnic Relations Perceptions Poll) 67% of Malaysians want each ethnic group to maintain its own cultural identity; however, 10% of the Malays prefer all people to practice Malay cultural traditions. A further 25% of Malaysians would like to see different cultures mix and give birth to a new unique set of traditions. (Merdeka Centre Ethnic Relations Perceptions Poll) 90% are proud to be Malaysian, and 93% have never thought of emigrating to another country. (Merdeka Centre Ethnic Relations Perceptions Poll) 40% of Chinese and Indians believe they are second-class citizens. A vast majority of Malaysians — 94% — however say that no matter how difficult ethnic relationships sometimes get, Malaysians should consider themselves lucky to live here. Merdeka Centre Ethnic Relations Perceptions Poll) There is a clear divide about the political direction of the country. Non-Malays are nearly unanimous in hoping that all cultures and religions will be given equal rights, but this is shared by only 38% of the Malays. 16% favour a Malay-dominant country, while 43% would like a more Islamic country. (Merdeka Centre Ethnic Relations Perceptions Poll) While 46% of Malaysians, most of them Malay, believe that Malaysian society is mature enough to discuss racial and religious issues openly, 49% think that these issues are too sensitive to merit an open discussion. Merdeka Centre Ethnic Relations Perceptions Poll) 55% of Malaysians believe that politicians are to blame for segregating the people through racial politics. A slim majority of the Malays, however, disagree. (Merdeka Centre Ethnic Relations Perceptions Poll) The most popular of five different proposals to improve national unity was the implementation of just and fair government policies, favoured by 34% of Malaysians, especially 59% of the Chinese. The next-most popular suggestion was to hold more programs such as National Service and Rukun Tetangga, garnering support from 22%. (Merdeka Centre Ethnic Relations Perceptions Poll) Not H arm onious at al 2 3 4 5 6 7 8 9 Malay Chinese Indian/Others 0 10 20 30 40 race q7a_1 V er y Harmonious Percent Source: CPPS Minda Muda study Respondents from the Malay ethnic group rated religious harmony significantly higher than did those from Chinese and Indian/ others ethnic groups. This is visible from 22% of Malays giving high ratings (9 and 10 on a 10-point scale) to religious harmony, compared to 13% of Indians/others and only 1% of Chinese. The mean Malay rating for religious harmony was 7. 3, as opposed to 5. 5 for Chinese respondents and 6. 8 for Indians/Others. POLICY RECOMMENDATIONS The government’s focus should be on the initiatives to promote Malaysia’s domestic entrepreneurial capacity. As history has indicated, entrepreneurial capacity cannot be cultivated primarily through selective patronage and easy access to bank loans and government concessions. The need now is for the promotion of policies based on merit. Immediate implementation of a more merit-based public personnel system in the civil service for enhancing equality of opportunity in recruitment and career advancement. The various public service commissions should be made more representative in order to enhance public confidence in their guardianship of the merit system. Annual intake of fresh recruits should comprise 60 percent of Malays and 40 percent of non-Malays. Terminate the policy and practice of having some public tertiary institutions open to only specific ethnic groups. Set out clear and transparent criteria of admissions applicable to all public tertiary institutions. The criteria should include a weighting for socio-economic and geographical/regional background to compensate for socio-economic and geographical/ regional disadvantage. Introduce/expand the provision of scholarships for academic excellence, to be applied to the top 5 per cent of applicants/ enrolees in selected fields assessed as critical to Malaysia’s social, cultural and economic needs and future. Introduce a provision for scholarships to the next 5 per cent of applicants/enrolees in selected fields assessed as critical to the civil service. Introduce/ expand a loan scheme for all others that will be discounted in proportion to academic achievement, that is, achievement of highest honours will result in a conversion of 80 per cent of the loan to a scholarship, and so on. This addresses issues of affordability, while simultaneously factoring in an incentive to performance. End all explicit or implicit quotas in the recruitment and promotion of faculty as it is ridiculous to entrust the higher education of our young to any but the most qualified. Consideration should be given to the establishment of a special department or agency to look after non-Bumiputera ethnic minority affairs, and especially to provide oversight in the fair and unbiased implementation of government programmes. Such an agency should be broad based and include representatives from government, interest groups, ethnic minority communities and NGOs. National Unity CPPS Policy Factsheet: National Unity CPPS is pleased to bring to you its â€Å"CPPS Policy Fact Sheet† on national unity. In this factsheet, we will look at government policies which affect national unity and explore their effects on social cohesion and integrity in Malaysia. BACKGROUND Malaysia is one of the most plural and heterogeneous countries in the world, with three major ethnic groups — Malay, Chinese, and Indian — plus several other indigenous tribes. It has a checkered history, having been under four different colonial powers at one time or another since the 16th century. This ethnic and cultural diversity is reflected in the wide variety of languages spoken and religions practiced in Malaysia; even within the same ethnic group, various traditions prevail. Modern Malaysia is increasingly forced to confront the tensions arising from this fount of diversity, and the politics of race and religion. Malaysia has been free of ethnic bloodshed, but there remains much room for Malaysians to understand one another and to see each other as equal parts of an indivisible nation. National unity is a key target of government policy; the Department of National Unity is tasked with promoting greater integration amongst the country’s various communities. However, numerous government policies and laws differentiate between Malaysians on the basis of ethnic background, to the point that many feel they have been the target of discrimination. Overall Malaysians are pleased with the progress the country has made in coming to terms with its plural and diverse nature. Yet, there is still significant room for improvement and ensuring that every Malaysian believes there is a place for them under the Malaysian sun. FLASH POINTS The Department of National Unity defines national unity as â€Å"a situation in which all citizens from the various ethnic groups, religions, and states live in peace as one united nationality, giving full commitment to national identity based upon the Federal Constitution and the Rukunegara. † Wawasan 2020 (Vision 2020), a government policy targeting developed status for Malaysia by the year 2020, names national unity as a key component of a developed country. The â€Å"Bangsa Malaysia† (Malaysian Nation) policy mphasises â€Å"people being able to identify themselves with the country, speak Bahasa Malaysia (the Malay language) and accept the Constitution. † Prior to Bangsa Malaysia, the government’s main thrust towards national unity was the National Culture Policy implemented in 1971, which defined the â€Å"indigenous culture† and Islam as two important bases for the national culture. The 2006 National Education Blueprint targets ra cial polarisation in the school system, aiming to use classes on the Constitution and other such activities to bring students together, while promoting Mandarin and Tamil classes in national schools. In 2008, the government announced new quotas for government scholarships, with 55% allocated to the bumiputra and 45% for non-bumiputra; previously the quota stood at 90% to 10%. The old ethnic quota system in university admissions was abolished in 2004. The National Service programme which commenced in 2003 is meant to address racial polarisation and encourage national unity by bringing youths from a variety of backgrounds together in one setting. The New Economic Policy and other associated affirmative action programmes have helped dampen Malay fears of falling behind the rest of the nation socioeconomically, but also led to concerns of government-backed discrimination amongst the non -Malay communities. BASIC STATISTICS and FACTS Malays and other bumiputra comprise 65% of the population; Chinese make up 26%, and the Indians 8%. (2000 census) 60. 4% of Malaysians are Muslim, 19. 2% are Buddhist, 9. 1% are Christian, 6. 3% are Hindu, 2. % follow Confucianism/Taoism/ another traditional Chinese faith, and 2. 4% practice other faiths. (2000 census) 93% of Malays attend national schools, 90% of Chinese attend Chinese vernacular schools, and 70% of Indians attend Tamil vernacular schools. (Prime Minister’s address to the 2004 Malaysian Education Summit) Bumiputra corporate equity stands at 19. 4%. (Mid-Term Review of the 9th Malaysia Plan) 41% of Malaysians either describe national unity as â€Å"superficial† or â₠¬Å"imposed†, or believe there is no national unity at all in Malaysia. Merdeka Centre Ethnic Relations Perceptions Poll) 25% believe that Malaysians from different ethnic groups are drifting apart rather than becoming more united, and 15% believe that the situation will only worsen over the next decade. (Merdeka Centre Ethnic Relations Perceptions Poll) There is a clear correlation between age and mixing outside one’s own ethnic group; younger Malaysians are likelier to say they find it difficult to relate with those not from their own racial background, and less likely to say they like mixing with people of a different race. CPPS Minda Muda study) 22% do not have any friends from ethnic groups other than their own. Of those who do, 60% rarely or never take meals with their friends from other ethnic backgrounds. (Merdeka Centre Ethnic Relations Perceptions Poll) Roughly 2/3rds of young Malaysians’ close friends are primarily from the same ethnic group or religion as them. (CPPS Minda Muda study) Only 57% of Malaysians believe that government policies should focus on promoting interests common to all Malaysians, with 25% believing that government policies should focus on the interests of specific ethnic groups. Merdeka Centre Ethnic Relations Perceptions Poll) 75% of young Malays can say they have never been treated unfairly on account of their race; however, only 45% of their Chinese peers and 49% of the Indians say the same. For religious discrimination, the same figures stand at 82% for the Malays and 53% for others. (CPPS Minda Muda study) Recent polls suggest that ethnic inequality is the 2nd-most pressing issues faced by Malaysians, at 17%, with only price hikes and inflation considered more pressing, coming in at 20%. 3% are somewhat or very dissatisfied with government efforts to address ethnic inequality. (Merdeka Centre Voter Opinion Poll 4 th Quarter 2007) Article 153 of the Federal Constitution states: â€Å"It shall be the resp onsibility of the Yang di-Pertuan Agong to safeguard the special position of the Malays and natives of any of the States of Sabah and Sarawak and the legitimate interests of other communities in accordance with the provisions of this Article. † Article 153 has been used to permit quotas in the provision of public scholarships, civil service positions, and business licences. EDUCATION POLICIES Young Chinese Malaysians are considerably dissatisfied with the state of the education system when it comes to promoting national unity. (CPPS Minda Muda study) 64% of Chinese parents feel the education system is preparing students to be tolerant towards those of other races and religions, as opposed to 78% of Malay parents and 83% of Indian parents. (Merdeka Research Centre Education System Perceptions Survey) 86% of Malaysians believe that the time has come for a national education convention involving all races to review various aspects of our education policies. Merdeka Centre Education System Perceptions Survey) 42% of Malaysian youth reject a quota system for admissions to public universities. (Merdeka Centre Youth Expectations Survey) 37% of Malaysians believe that the streaming of primary education based on mother tongue will negatively affect ethnic relations in the long run. (Merdeka Centre Ethnic Relations Perceptions Poll) 12% believe that the best way to improve ethnic relations in the country is to standardise on one education system. Merdeka Centre Ethnic Relations Perceptions Poll) Incidents of intolerance in the school system are often publicised in the media. Recently, a teacher told her students Indians were monkeys and children of prostitutes. The government’s response in such cases has been unsatisfactory; in here, the teacher was only transferred, with no further apparent penalty. Students often attend different primary school systems according to their mother tongue, curbing opportunities for interaction between young of different ethnic backgrounds. At the secondary level, many bumiputra students opt for one of the MARA junior science colleges or other bumiputra-dominated boarding schools, further reducing young Malaysians’ exposure to peers from different backgrounds. Universiti Teknologi Mara (UiTM) is exclusively attended by bumiputra students; suggestions by Selangor Chief Minister Tan Sri Khalid Ibrahim that it take in 10% of non-bumiputra was protested violently by students. A former Minister of Higher Education publicly declared that he would never see non-bumiputra students set foot on the campus. Although the quota system for university admissions has been abolished, there are regular calls from within the ruling party (Umno) for its restoration. Suspicions remain that the quota system is still in place by de facto, as the proportion of admitted bumiputra continues to hover between 50% and 60%. The quota system for government scholarships remains, and moves to increase the non-bumiputra quota or abolish the quotas entirely have come under fire. National Service is a popular remedial programme for racial integration; 73% of youth believe it has a positive effect on national unity, and 87% say it ought to be retained. Merdeka Centre Youth Expectations Survey) ECONOMIC POLICIES The NEP has ended but broadly refers to affirmative action for the Bumiputera in social, economic, corporate, distributive trade, and educational aspects. Its relevance has been debated recently, with some groups calling to replace this with a non-racebased affirmative action policy, focusing instead on n eed and meritocracy. A key target of the NEP was to have the bumiputra control 30% of corporate equity by 1990; when this target was not met, successor policies continued with a variety of bumiputra preferences. The 30% goal remains a key target in economic policy, and claims that it has already been attained have met with withering criticism Under the Industrial Coordination Act, the state has wide-reaching powers to achieve the 30% target. This power was most frequently used in the 1970s, when vast restructuring of numerous private enterprises took place. Public corporations must have a bumiputra equity stake of at least 30%, although there are exceptions granted. Tax breaks for companies with 30% or more bumiputra ownership are common. The state has taken over several foreign enterprises and established numerous government-linked corporations (GLCs) with the explicit purpose of increasing the bumiputra equity share. Loose employment quotas apply to large establishments, which must employ staff in the same proportions as the overall ethnic composition of the country. Similar quotas also apply to the boards of directors for a number of firms. Civil service positions are subject to even more stringent quotas; a common and targeted ratio is 4 bumiputra to 1 non-bumiputra. There are overt bumiputra preferences in public procurement, where construction contracts, etc. re frequently given to bumiputra-controlled firms without an open tendering process. Government policy is to encourage GLCs to follow government procurement procedures, extending the preferences to the commercial sector. In a controversial move, Maybank in 2007 announced it would only utilise law firms with a bumiputra ownership stake of 51% or more; after public outcry, the policy was rolled back. Price discrimination, whereby the government subsidises bumiputra contractors’ bids, is also a frequent practice. All new real estate developments are required to provide a certain discount for bumiputra buyers. Shares in initial public offerings (IPOs) meant for bumiputra ownership are also frequently sold at a discount. No government policy has ever set explicit targets for inter- or intra-ethnic income inequality. The government monitors the incomes of various ethnic groups, but reducing income disparities or uplifting the poor in general is not a major priority. Studies indicate significant dissatisfaction amongst the Chinese population with the government’s economic policies, which a substantial number perceive as detrimental to national unity. CPPS Minda Muda study) 39% of Malaysian youth believe that Malay preferences in government assistance ought to be abolished. (Merdeka Centre Youth Expectations Survey) Source: CPPS Minda Muda study Policies for a Particular Group Only Sta teme nts on Econ Policies good for Economic unity Policie s 1. 17 1. 04 1. 96 0 1 2 3 4 5 2. 17 1. 93 2. 48 4. 01 3. 4 4. 2 Indian/Others Chinese Malay NEP good for unity RELIGION and the LAW Amongst non- Muslims, concern is growing that Islamic law as practiced in Malaysia impinges on some of their rights. The Lina Joy case in 2007 ended with the apex Federal Court ruling 2-1 that Malaysians legally defined as Muslims cannot convert out of Islam without going through the Muslim Syariah court system. In 2005 Maniam Moorthy (also known as Mohammad Abdullah) was buried as a Muslim because official records indicated he had converted from Hinduism to Islam; his family protested as he had never given them any indication of conversion, and continued to practice the Hindu faith. The civil courts refused to hear the matter, and referred the Hindu family to the Muslim Syariah courts. In 2005, T. Saravanan converted from Hinduism to Islam, and filed an application in the Syariah Courts to dissolve his civil marriage and gain custody of his children. His wife, R. Subashini, insisted that only the civil courts could dissolve a civil marriage, but the civil courts held that they had no jurisdiction over the matter because as a Muslim Saravanan was now subject to Islamic family law. 2007 saw the case of Revathi Massosai, whose parents had registered her as a Muslim at birth, but had been raised as a practicing Hindu by her grandmother. When she filed an application to change her legal status from Muslim to Hindu, she was detained by Muslim religious authorities and sent for rehabilitation, where she claimed she was forced to consume beef and follow Muslim religious traditions. Numerous non-Muslim places of worship, primarily Hindu temples, have been demolished in recent years as illegal structures on public land. Non-Muslim activists claim that as historical landmarks, many of these buildings should have remained standing, and allege government discrimination in targeting non-Muslim places of worship. Interfaith dialogue has often been attacked as a challenge to the position of Islam, which is the official religion of Malaysia. Attempts to set up an Interfaith Commission have been rebuffed as a non-Muslim attempt to regulate Islamic beliefs, and civil society-organised forums on Muslim religious issues such as conversions have been forced to a premature close by vocal protests. Top government officials, including the present Prime Minister and his predecessor, have declared Malaysia an Islamic state although no related amendments to the law have been made. It is not clear what ramifications this has in store for the nonMuslim communities, but some fear this is an implicit justification for perceived injustices like the aforementioned cases. Mean Ranks Respondents were asked to rank on a 5-point scale the following statements, with â€Å"1† as â€Å"Fully Disagree† and â€Å"5† as â€Å"Fully Agree. The statements here read: â€Å"Government policies to help the poor should be for a particular group of Malaysians only. † â€Å"Government economic policies are good for national unity. â€Å"I think the NEP has been good to unite the country together. † IDENTITY and POLITICS 45% of Malaysians see themselves as Malaysian first, with 42% (including over half the Malays) identifying primarily as members of their respective ethnic groups. 12% believe they are equally Malaysians and equally members of their own ethnic communities. (Merdeka Centre Ethnic Relations Perceptions Poll) Young Malaysians have diff erent orientations; 40% say they see themselves as Malaysian first, but 39% — mostly Malay — identify primarily as the member of a religious group. 0% of Chinese Malaysian youths see themselves as a member of their own ethnic group first, as opposed to 7% each for the Malays, Indians and non-Muslim bumiputra. (DiGi Snapshot: MERDEKA Youth in Focus) Ethnic stereotyping is prevalent, with 58% of Malaysians saying Malays are lazy, 65% saying Chinese are greedy, and 58% saying Indians cannot be trusted. (Merdeka Centre Ethnic Relations Perceptions Poll) 70% of Malaysians believe they should help those from their own ethnic group first before helping others. Only 56% are more concerned about other Malaysians than their Muslim, Chinese or Indian counterparts overseas. (Merdeka Centre Ethnic Relations Perceptions Poll) 75% view their own culture as superior to other Malaysian cultures. However, 92% say they are happy to live in Malaysia because they get to enjoy different cultures. (Merdeka Centre Ethnic Relations Perceptions Poll) 67% of Malaysians want each ethnic group to maintain its own cultural identity; however, 10% of the Malays prefer all people to practice Malay cultural traditions. A further 25% of Malaysians would like to see different cultures mix and give birth to a new unique set of traditions. (Merdeka Centre Ethnic Relations Perceptions Poll) 90% are proud to be Malaysian, and 93% have never thought of emigrating to another country. (Merdeka Centre Ethnic Relations Perceptions Poll) 40% of Chinese and Indians believe they are second-class citizens. A vast majority of Malaysians — 94% — however say that no matter how difficult ethnic relationships sometimes get, Malaysians should consider themselves lucky to live here. Merdeka Centre Ethnic Relations Perceptions Poll) There is a clear divide about the political direction of the country. Non-Malays are nearly unanimous in hoping that all cultures and religions will be given equal rights, but this is shared by only 38% of the Malays. 16% favour a Malay-dominant country, while 43% would like a more Islamic country. (Merdeka Centre Ethnic Relations Perceptions Poll) While 46% of Malaysians, most of them Malay, believe that Malaysian society is mature enough to discuss racial and religious issues openly, 49% think that these issues are too sensitive to merit an open discussion. Merdeka Centre Ethnic Relations Perceptions Poll) 55% of Malaysians believe that politicians are to blame for segregating the people through racial politics. A slim majority of the Malays, however, disagree. (Merdeka Centre Ethnic Relations Perceptions Poll) The most popular of five different proposals to improve national unity was the implementation of just and fair government policies, favoured by 34% of Malaysians, especially 59% of the Chinese. The next-most popular suggestion was to hold more programs such as National Service and Rukun Tetangga, garnering support from 22%. (Merdeka Centre Ethnic Relations Perceptions Poll) Not H arm onious at al 2 3 4 5 6 7 8 9 Malay Chinese Indian/Others 0 10 20 30 40 race q7a_1 V er y Harmonious Percent Source: CPPS Minda Muda study Respondents from the Malay ethnic group rated religious harmony significantly higher than did those from Chinese and Indian/ others ethnic groups. This is visible from 22% of Malays giving high ratings (9 and 10 on a 10-point scale) to religious harmony, compared to 13% of Indians/others and only 1% of Chinese. The mean Malay rating for religious harmony was 7. 3, as opposed to 5. 5 for Chinese respondents and 6. 8 for Indians/Others. POLICY RECOMMENDATIONS The government’s focus should be on the initiatives to promote Malaysia’s domestic entrepreneurial capacity. As history has indicated, entrepreneurial capacity cannot be cultivated primarily through selective patronage and easy access to bank loans and government concessions. The need now is for the promotion of policies based on merit. Immediate implementation of a more merit-based public personnel system in the civil service for enhancing equality of opportunity in recruitment and career advancement. The various public service commissions should be made more representative in order to enhance public confidence in their guardianship of the merit system. Annual intake of fresh recruits should comprise 60 percent of Malays and 40 percent of non-Malays. Terminate the policy and practice of having some public tertiary institutions open to only specific ethnic groups. Set out clear and transparent criteria of admissions applicable to all public tertiary institutions. The criteria should include a weighting for socio-economic and geographical/regional background to compensate for socio-economic and geographical/ regional disadvantage. Introduce/expand the provision of scholarships for academic excellence, to be applied to the top 5 per cent of applicants/ enrolees in selected fields assessed as critical to Malaysia’s social, cultural and economic needs and future. Introduce a provision for scholarships to the next 5 per cent of applicants/enrolees in selected fields assessed as critical to the civil service. Introduce/ expand a loan scheme for all others that will be discounted in proportion to academic achievement, that is, achievement of highest honours will result in a conversion of 80 per cent of the loan to a scholarship, and so on. This addresses issues of affordability, while simultaneously factoring in an incentive to performance. End all explicit or implicit quotas in the recruitment and promotion of faculty as it is ridiculous to entrust the higher education of our young to any but the most qualified. Consideration should be given to the establishment of a special department or agency to look after non-Bumiputera ethnic minority affairs, and especially to provide oversight in the fair and unbiased implementation of government programmes. Such an agency should be broad based and include representatives from government, interest groups, ethnic minority communities and NGOs.